Synthetic sgRNA: Ranges from 97 to 170 nt or More, With Over 90% HPLC GMP Purity

Experience Unparalleled Quality and Purity in Your CRISPR Research with Our Premium Synthetic sgRNA.

Single-guide RNA (sgRNA) is an essential component of the CRISPR-Cas gene editing system. When paired with the Cas protein, it facilitates the precise cutting or modification of specific genes.

Fig.1, The Roles and Mechanisms of sgRNA in the CRISPR-Cas Gene Editing System.

Advancing sgRNA Synthesis: new Modality Enzymatic Convergent Assembly (nMECA)´s Enhanced Length and Purity sgRNA synthesis in a Good Manufacturing Practice (GMP) certified environment.

Table 1: Comparative Advantages of nMECA sgRNA Over Conventional sgRNAs in Cell Engineering

  • Universal Compatibility: "Unlock the full potential of gene editing across a broad spectrum of cell types with our nMECA sgRNA. From the delicate intricacies of stem cells to the robust nature of cell lines, our product seamlessly adapts, ensuring your research can thrive in any cellular environment."
  • Precision Engineering: "Elevate the accuracy of your gene editing with nMECA sgRNA. Our cutting-edge solution drastically minimizes off-target effects, ensuring that your genetic modifications are precise, clean, and reliable—every time."
  • Superior Consistency: "Achieve over 90% editing efficiency with our nMECA sgRNA, and experience the peace of mind that comes with consistent results. Superior performance is not an option—it's a guarantee."
  • Streamlined Process: "Save valuable time and accelerate your workflow. Our nMECA sgRNA sidesteps the time-consuming steps associated with plasmid cloning and the labor-intensive IVT method, delivering a swift and efficient path to success."
  • Enhanced Safety Profile: "Protect your cellular models with nMECA sgRNA, designed to minimize genomic integration and reduce the risk of adverse cellular effects. With safety at the forefront, you can focus on innovation without compromise."
  • Reduced Immunogenicity: "Advance your research without the fear of triggering unwanted immune responses. Our nMECA sgRNA is engineered to keep the innate immune defenses at bay, paving the way for smoother, more successful gene editing."

Data

We are proud to present the quality benchmarks for our sgRNA products from Pixel Biosciences. We offer custom sgRNA sequences extending from 97 to 170 nucleotides and beyond, characterized by exceptional purity, enhanced stability, and minimal cell immunogenicity for effective gene editing and knockout efficiency.

The integrity of our sgRNA is evidenced by Urea-PAGE electrophoresis, with each target band confirmed to be distinct and free from impurities, achieving an analysis-purified result exceeding 90%, as shown in Figures 2 and 3. Our commitment to quality is further demonstrated by HPLC analysis, verifying that our final product maintains a purity level above 90%. Specifically, as illustrated in Figure 4, the predicted molecular weight of a sample sgRNA is 33427.8, while LC-MS analysis confirms an actual molecular weight of 33430.4—representing a minimal variance of only 0.008%, well below the stringent 0.05% error margin.

  • Superior purity with customizable long sgRNA strands

Fig. 2. Superior purity of nMECA sgRNA over chemically modified counterparts.

Fig 3. Utilizing Urea-PAGE detection guarantees the presence of a singular target band HPLC grade sgRNA, free from extraneous contaminants. Band purity is meticulously quantified through 'ImageJ' software analysis, confirming that purity surpasses the 90% threshold.

Fig. 4. The purity of the final HPLC grade sgRNA is validated to be over 90% through HPLC analysis, employing peak area normalization for precision. The anticipated molecular weight is corroborated by LC-MS assessment, maintaining an accuracy within 0.005 units.

Superior knockout efficiency.

Fig. 5. Superior knockout efficiency of nMECA sgRNA over chemically modified counterparts.

Product Specifications and purchase information

Step into the future of gene editing with our premium nMECA sgRNA—where efficiency, precision, and safety are not just goals but standards we deliver.

Select from a range of nMECA technology-produced sgRNAs, available both modified and unmodified for research use only (RUO). Our offerings include diverse purification options tailored to yield quantities that align with your experimental requisites.

*Our standard SpCas9 scaffold sequences are: “GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG*mC*mU*mU*mU*mU”

Applications of CRISPR-Cas

Over the last decade, CRISPR-Cas has excelled in gene knockouts, animal model creation, genetic screening, and precision gene editing through innovations like base editing. These achievements have set the stage for its entry into clinical practice, marked by the FDA approval of Casgevy, a CRISPR-based therapy for sickle cell disease. This development indicates the potential for CRISPR-Cas to create more FDA-approved therapies, advance crop engineering, and contribute to xenotransplantation. Integrating with technologies like machine learning, CRISPR-Cas is evolving from a research tool to a mainstay in biotechnological applications in health and agriculture.

Fig. 6: CRISPR: past, present, and future.

The past decade of CRISPR technology has focused on building the platforms for generating gene knockouts, creating knockout mice and other animal models, genetic screening, and multiplexed editing. CRISPR’s applications in medicine and agriculture are already beginning and will serve as the focus for the next decade as society’s demands drive further innovation in CRISPR technology.

CRISPR technology: A decade of genome editing is only the beginning, Volume: 379, Issue: 6629, DOI: (10.1126/science.add8643)